NASC Stock Detail Page
NASC ID: N67175
Name: P1E7-1-4
ABRC stock number: CS67175
Description: This whole-gene translation fusion was generated by recombineering (Zhou et al. (2001) Plant J. 66:712-723). The Venus yellow fluorescent protein DNA sequence (obtained from Dr. Oliver Hobert at Columbia University Medical Center, New York. (ref. PLoS ONE 4(3): e4625. doi:10.1371/journal.pone.0004625) was inserted just after the following sequence:ATTCCACGGCGGAGCTAGAGGCGGCTGGTGGAGATGGCGGCGGCAACAAC (internal fusion in the gene At2g01420/PIN4) in the JAtY clone JAtY68B17. Transgenic plants are homozygous, but can be selected in BASTA.
Donation Date: 2012-02-17
Donated by: | North Carolina State University Jose M. Alonso North Carolina State University Anna Stepanova |
Donor Number: P1E7-1-4
Stock type: individual line
Material type: seed
Comment: Donors: Jose M. Alonso, Anna N. Stepanova, Jeonga Yun. Parents: Col(Columbia). Associated Constructs: Alonso-P1E7.
Status | Price (£) |
---|---|
Available | £11.00 |
Germplasm Info
Seed type: Sequence tagged
Background: Col(Columbia)
Growth requirement: none
Phenotype
No visible phenotype
References
Zhou et al. 2011. A recombineering-based gene tagging system for Arabidopsis. The Plant Journal 66(4):712-23. PubMed ID: 21294796