Home | About NASC | Address/Staff
Ask a question | Help

NASC

The European Arabidopsis Stock Centre

NASC Stock Detail Page

NASC ID: N67175

Name: P1E7-1-4

ABRC stock number: CS67175

Description: This whole-gene translation fusion was generated by recombineering (Zhou et al. (2001) Plant J. 66:712-723). The Venus yellow fluorescent protein DNA sequence (obtained from Dr. Oliver Hobert at Columbia University Medical Center, New York. (ref. PLoS ONE 4(3): e4625. doi:10.1371/journal.pone.0004625) was inserted just after the following sequence:ATTCCACGGCGGAGCTAGAGGCGGCTGGTGGAGATGGCGGCGGCAACAAC (internal fusion in the gene At2g01420/PIN4) in the JAtY clone JAtY68B17. Transgenic plants are homozygous, but can be selected in BASTA.

Donation Date: 2012-02-17

Donated by:  North Carolina State University Jose M. Alonso
North Carolina State University Anna Stepanova

Donor Number: P1E7-1-4

Stock type: individual line

Material type: seed

Comment: Donors: Jose M. Alonso, Anna N. Stepanova, Jeonga Yun. Parents: Col(Columbia). Associated Constructs: Alonso-P1E7.

Status Price (£)
Available £11.00

Germplasm Info

Seed type: Sequence tagged

Background: Col(Columbia)

Growth requirement: none

Phenotype

No visible phenotype

References

Zhou et al. 2011. A recombineering-based gene tagging system for Arabidopsis. The Plant Journal 66(4):712-23. PubMed ID: 21294796