General Background

• Comparative genomics review

Specific Resources - Introduction

What is the state of the genomics art at the moment ? :

• Ensembl @ EBI
• All genomes sequenced (data at NCBI)
• GOLD (Genomes OnLine Database)
• Genomics papers - all you wanted to know about your chosen species

  For example - compare cats and humans, why do it ? and what does it look like:

• Reasons to sequence a cat
• Cats and people show conserved synteny

  So, what types of NEW things do we get to know from sequencing ?

• The Arabidopsis genome is more complex than we thought
• Of mice, men and grasses - synteny can be observed at many levels
• Demonstration of the usefulness of synteny
• Projects are now sequencing the sea, air, caves and other environmental samples

Practical: Familiarity with AtEnsembl.

• AAACGATCATCTGGACAAGAGAACATGGACTTACATATTTGGCGCGTGTTGTGCAACCAC
• AtEnsembl