NASC

NASC ID: N2111492

Name: DEX>>MAX4 max4-1

ABRC stock number: CS2111492

Description: To generate plants in which MAX4 expression could be exogenously induced with dexamethasone (DEX), a two-component system was used (Craft et al., 2005). In this system, the DEX receptor is fused N-terminally to a chimeric transcription factor consisting of the lac repressor as a DNA-binding domain and the GAL4 transcriptional activation domain. This protein, designated LhG4-N, has been introduced into plants under the control of the CaMV 35S promoter (Craft et al., 2005). On a separate construct, any gene of interest can be fused to a promoter including lac repressor binding elements, thus rendering it DEX-inducible in the presence of LhG4-N. An expression cassette allowing such fusion to be generated (pH–TOP–GUS) also includes a GUS gene expressed divergently from the same promoter, such that DEX inducibility can be monitored using GUS activity (Craft et al., 2005). WT plants, homozygous for the LhG4-N trans-acting construct (Craft et al., 2005), were crossed to max4 mutants and F2 plants with the max4 phenotype and homozygous for the LhG4-N transgene were identified. The MAX4 cDNA was cloned into the pH–TOP–GUS vector. The MAX4 coding sequence was amplified by PCR from MAX4 cDNA in pUC18. The forward primer (5'–GCCTCGAGATGGCTTCTTTGATCACAA–3') introduced an XhoI site immediately 5' to the MAX4 ATG. The reverse primer (5'–GCGGATCCTGTGATCAAAGAAGC–3') included a BglII site 3' to the MAX4 stop codon. The PCR product was cloned into the pCR2.1–TOPO vector (Invitrogen). The resultant MAX4 XhoI and BglII fragment was cloned into pH–TOP–GUS (which confers hygromycin resistance), cut with BamHI and SalI. The resultant plasmid was transformed into Agrobacteria and introduced into max4 LhG4-N background by floral dip (Clough and Bent, 1998). Three independent transformed lines were selected for further analysis and, from these, one was chosen for future studies based on uniform GUS induction with DEX application.

Donation Date: 2022-07-22

Donated by:

University of Cambridge Jean Dillon University of Cambridge Ottoline Leyser University of York Veronica Ongaro

Donor Number: OL0208

Stock type: individual line

Material type: seed

Status	Price (£)
Available	£11.00

Germplasm Info

Genus: Arabidopsis     Species: thaliana

Seed type: Transgenic

Mutagen: Agrobacterium tumefaciens-mediated method

Background: Col-0

Segregation status: homozygous

Growth requirement: none

Associated Polymorphisms

When available, select a locus to display it at the AIP or view the EMBL record at the EBI.

Gene:	Allele:	Locus:	AGI code:
more axillary branching 4			AT4G32810

Phenotype

Phenotype as for max4-1. DEX-treatment resulted in restoration of wild-type branching. The construct used for DEX-inducible MAX4 expression includes a GUS gene under the control of the same DEX-dependent promoter; thus, GUS expression can be used to monitor DEX activity.

References

Veronica Ongaro, Katherine Bainbridge, Lisa Williamson, Ottoline Leyser; 2008-03-01; Interactions between axillary branches of Arabidopsis; Mol Plant; PubMed ID: 19825548