NASC Stock Detail Page
NASC ID: N69690
Name: tir1-9
ABRC stock number: CS69690
Description: Isolated from the K. Feldmann T-DNA collection. The T-DNA insertion replaces the region including the last 71 bp of the first intron to the first 4 bp of exon 2. Both 5' and 3' junctions were amplified with LB primer (catagatgcactcgaaatcagc) and sequenced.
Donation Date: 2016-11-28
Donated by: | University of California San Diego Mark Estelle University of California San Diego Mike Prigge |
Donor Number: tir1-9
Stock type: individual line
Material type: seed
Comment: Donor names: Mike Prigge, Mark A. Estelle. Clone name: 3850:1003. Associated polymorphisms: tir1-9
Status | Price (£) |
---|---|
Available | £11.00 |
Germplasm Info
Mutagen: T-DNA Insertion
Background: Ws-2 (N2360)
Growth requirement: none
Phenotype
Resistant to IAA.
References
Ruegger, M. et al. 1998. The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast grr1p. Genes & Development 12(2):198-207. PubMed ID: 9436980.