Home | About NASC | Address/Staff
Ask a question | Help

NASC

The European Arabidopsis Stock Centre

NASC Stock Detail Page

NASC ID: N69690

Name: tir1-9

ABRC stock number: CS69690

Description: Isolated from the K. Feldmann T-DNA collection. The T-DNA insertion replaces the region including the last 71 bp of the first intron to the first 4 bp of exon 2. Both 5' and 3' junctions were amplified with LB primer (catagatgcactcgaaatcagc) and sequenced.

Donation Date: 2016-11-28

Donated by:  University of California San Diego Mark Estelle
University of California San Diego Mike Prigge

Donor Number: tir1-9

Stock type: individual line

Material type: seed

Comment: Donor names: Mike Prigge, Mark A. Estelle. Clone name: 3850:1003. Associated polymorphisms: tir1-9

Status Price (£)
Available £11.00

Germplasm Info

Mutagen: T-DNA Insertion

Background: Ws-2 (N2360)

Growth requirement: none

Phenotype

Resistant to IAA.

References

Ruegger, M. et al. 1998. The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast grr1p. Genes & Development 12(2):198-207. PubMed ID: 9436980.