NASC Stock Detail Page
NASC ID: N67220
Name: P2F8-2-17
ABRC stock number: CS67220
Description: This whole-gene translation fusion was generated by recombineering (Zhou et al. (2001) Plant J. 66:712-723). The Ypet yellow fluorescent protein DNA sequence (Zhou et al. (2001) Plant J. 66:712-723) was inserted just after the following sequence: (i.e. just before the stop codon): AGTTGCAGGAACCTCTCCAGATAGAGCAGCCGCAAAATGCTACTGCTTTG of the gene At1g48850 in the JAtY clone JAtY67N05. Transgenic plants are homozygous, but can be selected in BASTA.
Donation Date: 2012-02-17
| Donated by: | North Carolina State University Jose M. Alonso North Carolina State University Anna Stepanova |
Donor Number: P2F8-2-17
Stock type: individual line
Material type: seed
Comment: Donors: Jose M. Alonso, Anna N. Stepanova, Jeonga Yun. Parents: Col(Columbia). Associated Constructs: Alonso-P2F8.
| Status | Price (£) |
|---|---|
| Available | £11.00 |
Germplasm Info
Seed type: Sequence tagged
Background: Col(Columbia)
Growth requirement: none
Phenotype
No visible phenotype
References
Zhou et al. 2011. A recombineering-based gene tagging system for Arabidopsis. The Plant Journal 66(4):712-23. PubMed ID: 21294796