NASC Stock Detail Page
NASC ID: N68750
Name: sgt1a
ABRC stock number: CS68750
Description: Identified by PCR genotyping from SALK line (SALK_122139). Homozygous sgt1aKO mutant plants were selected with three PCR primers: Primer LP: CTTGAAAAGGGTGCCTCTATCACGC; Primer RP: CATCAGATGACACTGAAGAAGGAAAAGG; SALKLB: CCACCATCAAACAGGATTTTCGCCTGCTGGGGC. LP and RP are flanking primers, amplify in absence of insertion. RP and SALKLB are insertion specific primers, amplify in presence of insertion.
Donation Date: 2014-06-25
| Donated by: | University of North Carolina, Chapel Hill Jeff Dangl |
Donor Number: sgt1a
Stock type: individual line
Material type: seed
| Status | Price (£) |
|---|---|
| Available | £11.00 |
Germplasm Info
Mutagen: T-DNA Insertion
Background: Col-0(N60000, SALK_122139)
Growth requirement: none
Phenotype
No visible phenotype.
References
Holt, B.F., Belkhadir, Y. & Dangl, J.L. 2005. Antagonistic control of disease resistance protein stability in the plant immune system. Science 309(5736):929-32.PubMed ID: 15976272.