NASC Stock Detail Page
NASC ID: N69582
Name: C6-11-5
ABRC stock number: CS69582
Description: This whole-gene translation fusion was generated by recombineering (Zhou et al. (2001) Plant J. 66:712-723). The 3xYpet yellow fluorescent protein DNA sequence (Zhou et al. (2001) Plant J. 66:712-723) was inserted just after the following sequence: (i.e. just before the stop codon): GAGGAAGCTCTGATCGAAGCATTAACGAGTTTATAGAGAGTTTAGGGAAG of the gene At1g24100 in the JAtY clone JAtY72N13. Homozygous for the transgene. Basta resistant.
Donation Date: 2016-08-08
Donated by: | North Carolina State University Jose M. Alonso North Carolina State University Anna Stepanova North Carolina State University Jeonga Yun |
Donor Number: C6-11-5
Stock type: individual line
Material type: seed
Comment: Donor names: Jeonga Yun, Anna N. Stepanova, Jose M. Alonso. Clone name: Alonso-P2B10
Status | Price (£) |
---|---|
Available | £11.00 |
Germplasm Info
Seed type: Protein fusion
Background: Col(Columbia)
Growth requirement: none
Phenotype
No visible phenotype.
References
Zhou et al. 2011. A recombineering-based gene tagging system for Arabidopsis. The Plant Journal 66(4):712-23. PubMed ID: 21294796