Home | About NASC | Address/Staff
Ask a question | Help

NASC

The European Arabidopsis Stock Centre

NASC Stock Detail Page

NASC ID: N69582

Name: C6-11-5

ABRC stock number: CS69582

Description: This whole-gene translation fusion was generated by recombineering (Zhou et al. (2001) Plant J. 66:712-723). The 3xYpet yellow fluorescent protein DNA sequence (Zhou et al. (2001) Plant J. 66:712-723) was inserted just after the following sequence: (i.e. just before the stop codon): GAGGAAGCTCTGATCGAAGCATTAACGAGTTTATAGAGAGTTTAGGGAAG of the gene At1g24100 in the JAtY clone JAtY72N13. Homozygous for the transgene. Basta resistant.

Donation Date: 2016-08-08

Donated by:  North Carolina State University Jose M. Alonso
North Carolina State University Anna Stepanova
North Carolina State University Jeonga Yun

Donor Number: C6-11-5

Stock type: individual line

Material type: seed

Comment: Donor names: Jeonga Yun, Anna N. Stepanova, Jose M. Alonso. Clone name: Alonso-P2B10

Status Price (£)
Available £11.00

Germplasm Info

Seed type: Protein fusion

Background: Col(Columbia)

Growth requirement: none

Phenotype

No visible phenotype.

References

Zhou et al. 2011. A recombineering-based gene tagging system for Arabidopsis. The Plant Journal 66(4):712-23. PubMed ID: 21294796