Sample TC Report TC8901

Sample TC Report: TC8901

Shown below is a sample report for the assembly TC8901. There are three parts to the report.

The consensus sequence of the assembly, a list of the previous assemblies that these ESTs belonged to and its putative identification if any.
A schematic diagram of the makeup of the assembly.
Further information and relevant links for each underlying sequence.
- # : - Reference number from the schematic diagram
- ID: - Link to an individual report on this sequence.
- GB#: - Link to the GenBank Entry for this sequence.
- Clone_Name: - Link to the homology information at University of Minnesota's Database.
- Left/Right : - Coordinates of the sequence within the assembly.
- Library: - The tissue in which the cDNA was was found.
Click on any of the underlined entries to see a sample of the information available. Only sample entries are linked for this tutorial to save space.

>TC8901 TC1590 TC5269
TCCTCACTTTCATCAGCCGTTTTGAATCTCCGGCGACTTGACAGAGAAGAACAAGGAAGAAGACTAAGAGAGAAAGTAAG
AGATAATCCAGGAGATTCATTCTCCGTTTTGAATCTTCCTCAATCTCATCTTCTTCCGCTCTTTCTTTCCAAGCTCATAA
AAAATGGCTGAGGCTGATGATATTCAACCAATCGTGTGTGACAATGGTACCGGTATGGTGAAGGCTGGATTTgCAGGAGA
TGATGCTCCCAGGGCTGTTTTTCCCAGTGTTGTTGGTAGGCCAAGACATCATGGTGTCATGGTTGGgATGAACCAGAAGG
ATGCATATgTTgGTGATGAAGCACAATCCAaGaGAGGtATTCTTACCcTTGAAnGTATCCTaTTgAGCATGGTGTTkTTA
GCAAcTgGGGnTGkTATGGGAAAnATCTGGCATCACACTTTCnTTCAATGAGcTTCGtATTTCTCCnTgAAGGGnAnCCC
TkTnCTTnTTaCCGnGGnTCtTTTAmCCCAAgGCCACCAGGGGAGGTGnCTnAATCAATGTTnGnGCCCTTAnnTnCCCC
CCATTTTTTCGCCATCAAGCTnTTTCCCTTGnGnC
 
Putative ID: actin 1 isolog
 
 1===================================TC8901=================================595 
 --------------------------1-------------------------->                         
 ---------------2--------------->                                               
 ----------------------3---------------------->                                 
 ---------------------------4--------------------------->                       
 --------------------------------------5--------------------------------------> 
 -------------------------6------------------------>                            
  -----------------------7----------------------->                              
    <-------------------8--------------------                                   
    ------------------------------9------------------------------>              
          ----------------------------10--------------------------->            
          ---------------------11-------------------->                          
 

#       ID#        GB#     Clone_ID      left right library
-------------------------------------------------------------------------------
1     P_13774      R65270  168H2T7          1   414 mixed tissues (MSU-PRL2)
2     P_2897       T20889  89C9T7           2   265 mixed tissues (MSU-PRL2)
3     Q_ATTS1229   Z25952  VBV24-5992       2   353 seedlings
4     P_19276      N38049  217C7T7          3   423 mixed tissues (MSU-PRL2)
5     P_9998       T46735  141M5T7          3   597 mixed tissues (MSU-PRL2)
6     P_7022       T43759  123C3T7          4   411 mixed tissues (MSU-PRL2)
7     P_3829       T21821  103C21T7        11   431 mixed tissues (MSU-PRL2)
8     P_2722       T20714  91J14T7         25   334 mixed tissues (MSU-PRL2)
9     P_13106      R30501  164G21T7        28   498 mixed tissues (MSU-PRL2)
10    P_18447      N37237  207P22T7        73   514 mixed tissues (MSU-PRL2)
11    P_12402      R29797  161E2T7         73   406 mixed tissues (MSU-PRL2)


Sequence source codes: 
P = Michigan State
Q = French

Note there is no ET sequence (see the TC8203 report) in this assembly. During the identification stage, the consensus sequence of this assembly was similar but not identical to actin 1, hence the putative ID is given as 'actin 1 isolog'. In these cases the information provided at the University of Minnesota's database allows the user to assess the results of the Blast searches themselves. Follow the link in the 'Clone_name' column to see this data.

Back to the Name Search Page